225x Filetype PPT File size 1.51 MB Source: biology.hunter.cuny.edu
Preparation of Traditional Nucleic Acid Probe Amino acid sequence GLY-ASP-GLU-SER-SER-VAL-LEU----- GGG-GAC-GAG-TCC-TCC-GTT-CTC--- * * * * * * * Nucleic acid sequence * Codon degeneracy The nucleic acid sequence is Synthesizing Deduced from amino acid sequence oligonucleotide Chemical synthesis PROBE: GGGGACGAGTCCTCCGTTCT PROBE: GGGGACGAGTCCTCCGTTCT Juang RH (2004) BCbasics Probe is labeled with radioactive 32P GGGGACG Hybridization 32 AG P TC CT C C T G A CTG T T T CC CTC C C C A G T G G A G A A G G A G A CC C AT G G DNA Target gene denaturation Single colony Lysed Juang RH (2004) BCbasics Colony Is Screened by Hybridization with Probe Colony hybridization Cover with filter paper Transferring … Collect filter paper Dissolve cell DNA denatured Autoradiography Add probe s c i s a b C B ) 4 0 0 2 ( H R g n a u J Biochip Based on Hybridization Sample DNA Complementary DNA hybridize Biochip Each spot contains known DNA Signal appears Schena (2000) Microarray Biochip Technology, p. A31 Juang RH (2004) BCbasics
no reviews yet
Please Login to review.